2025 : 9 : 8
Nafiseh Davati

Nafiseh Davati

Academic rank: Associate Professor
ORCID: https://orcid.org/0000-0002-0064-0265
Education: PhD.
ScopusId: https://www.scopus.com/authid/detail.uri?authorId=56668680300
HIndex: 7/00
Faculty: Faculty of Food Industry, Bahar
Address: Associate professor, Department of Food Science and Technology, Bu‐Ali Sina University, Hamedan, Iran.
Phone:

Research

Title
My submission"Study of microbial diversity of ewe's yogurt from nomads using Next-Generation Sequencing, Mar 28 '20" has been published in NCBI
Type
Innovation
Keywords
STUDY: PRJNA624311 SAMPLE: F-R1 (SAMN14573419) EXPERIMENT: Sa-Yo-1:3 (SRX8095405) SRA accession: PRJNA624311 Temporary Submission ID: SUB7208628 Release date: 2020-04-12 RUN: F-R1_S34_L001_R1_001.fastq (SRR11524343) BioProject ID: PRJNA624311
Year
2020
Researchers Nafiseh Davati

Abstract

https://www.ncbi.nlm.nih.gov/Traces/study/?acc=PRJNA624311 https://www.ncbi.nlm.nih.gov/sra/PRJNA624311 The aim of this study was identification of microbial community of yogurt from ewe milk produced by nomads using next generation sequencing and assessment of sanitary quality of this yogurt . The V3 and V4 regions of 16S ribosomal RNA gene were amplified using Forward Primer 5'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG and Reverse Primer 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC Overhang adapter sequences were appended to the primer pair sequences for compatibility with Illumina index and sequencing adapters. The Illumina overhang adapter sequences to be added to locusspecific sequences were: Forward overhang: 5 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG [locus- specific sequence] Reverse overhang: 5 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG[locus- specific sequence]. Both contained an Illumina adapter region for sequencing on the Illumina MiSeq System. Then, Illumina sequencing on MiSeq was performed.