he aim of this study was identification of microbial community of pickled vegetables using next generation sequencing ripened in March. Design: The V3 and V4 regions of 16S ribosomal RNA gene were amplified using Forward Primer 5'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG and Reverse Primer 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC Overhang adapter sequences were appended to the primer pair sequences for compatibility with Illumina index and sequencing adapters. The Illumina overhang adapter sequences to be added to locusspecific sequences were: Forward overhang: 5 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG [locus- specific sequence] Reverse overhang: 5 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG[locus- specific sequence]. Both contained an Illumina adapter region for sequencing on the Illumina MiSeq System. Then, Illumina sequencing on MiSeq was performed.
