2025 : 6 : 7
Nafiseh Davati

Nafiseh Davati

Academic rank: Associate Professor
ORCID: https://orcid.org/0000-0002-0064-0265
Education: PhD.
ScopusId: https://www.scopus.com/authid/detail.uri?authorId=56668680300
HIndex: 0/00
Faculty: Faculty of Food Industry, Bahar
Address: Associate professor, Department of Food Science and Technology, Bu‐Ali Sina University, Hamedan, Iran.
Phone:

Research

Title
My submission" Study of microbial diversity of salad gojeh, a type of fermented vegetables, using Next-Generation Sequencing" has been published in NCBI
Type
Innovation
Keywords
SAMN34164032 SRS17299991 PRJNA777771 SRP344509
Year
2023
Researchers Nafiseh Davati

Abstract

https://www.ncbi.nlm.nih.gov/sra/PRJNA777771 https://trace.ncbi.nlm.nih.gov/Traces/?view=study&acc=SRP344509 https://www.ncbi.nlm.nih.gov/sra?term=SRP344509 https://www.ncbi.nlm.nih.gov/biosample/SAMN34164032 https://www.ncbi.nlm.nih.gov/sra?term=SAMN34164032 The aim of this study was identification of microbial community of salad gojeh using next generation sequencing and assessment of sanitary quality of this product. Design: The V3 and V4 regions of 16S ribosomal RNA gene were amplified using Forward Primer 5'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG and Reverse Primer 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC Overhang adapter sequences were appended to the primer pair sequences for compatibility with Illumina index and sequencing adapters. The Illumina overhang adapter sequences to be added to locusspecific sequences were: Forward overhang: 5 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG [locus- specific sequence] Reverse overhang: 5 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG[locus- specific sequence]. Both contained an Illumina adapter region for sequencing on the Illumina MiSeq System. Then, Illumina sequencing on MiSeq was performed.