2025 : 9 : 7
Nafiseh Davati

Nafiseh Davati

Academic rank: Associate Professor
ORCID: https://orcid.org/0000-0002-0064-0265
Education: PhD.
ScopusId: https://www.scopus.com/authid/detail.uri?authorId=56668680300
HIndex: 7/00
Faculty: Faculty of Food Industry, Bahar
Address: Associate professor, Department of Food Science and Technology, Bu‐Ali Sina University, Hamedan, Iran.
Phone:

Research

Title
My submission" "Study of microbial diversity of ewe's milk using Next-Generation Sequencing, Apr 12 '20" has been published in NCBI
Type
Innovation
Keywords
STUDY: PRJNA626631 SAMPLE: GSM4471939 (SAMN14573420) EXPERIMENT: Sa-ml-1:4 (SRX8143266) RUN: c1-R2_S8_L001_R1_001.fastq (SRR11575338) SAMPLE: GSM4471962 (SAMN14573421) EXPERIMENT: Sa-mk-1:4 (SRX8143267) RUN: c1-R3_S9_L001_R1_001.fastq (SRR11575337) SAMPLE: F-R1 (SAMN14573419) EXPERIMENT: Sa-mi-1:4 (SRX8143265) RUN: c1-R1_S7_L001_R1_001.fastq (SRR11575339) SRA accession: PRJNA626631 Release date: 2020-04-21 SubmissionID: SUB7276456 BioProject ID: PRJNA626631
Year
2020
Researchers Nafiseh Davati

Abstract

https://www.ncbi.nlm.nih.gov/sra/PRJNA626631 https://www.ncbi.nlm.nih.gov/Traces/study/?acc=PRJNA626631 http://www.ncbi.nlm.nih.gov/bioproject/626631 The aim of this study was identification of microbial community of ewe's milk produced by nomads using next generation sequencing and assessment of sanitary quality of this milk Design: The V3 and V4 regions of 16S ribosomal RNA gene were amplified using Forward Primer 5'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG and Reverse Primer 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC Overhang adapter sequences were appended to the primer pair sequences for compatibility with Illumina index and sequencing adapters. The Illumina overhang adapter sequences to be added to locusspecific sequences were: Forward overhang: 5 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG [locus- specific sequence] Reverse overhang: 5 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG[locus- specific sequence]. Both contained an Illumina adapter region for sequencing on the Illumina MiSeq System. Then, Illumina sequencing on MiSeq was performed.